Trevige Napa

Lab Reagents

Human IgG antibody Laboratories manufactures the trevige napa reagents distributed by Genprice. The Trevige Napa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Trevigen. Other Trevige products are available in stock. Specificity: Trevige Category: Napa

Serum / Plasma information

NAPA siRNA

20-abx925400
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAPA siRNA

20-abx925401
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAPA Blocking Peptide

33R-5853 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NAPA antibody, catalog no. 20R-1339

NAPA Conjugated Antibody

C31126 100ul
EUR 397

NAPA cloning plasmid

CSB-CL015447HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atggacaattccgggaaggaagcggaggcgatggcgctgttggccgaggcggagcgcaaagtgaagaactcgcagtccttcttctctggcctctttggaggctcatccaaaatagaggaagcatgcgaaatctacgccagagcagcaaacatgttcaaaatggccaaaaactggag
  • Show more
Description: A cloning plasmid for the NAPA gene.

NAPA Polyclonal Antibody

A59986 100 µg
EUR 570.55
Description: kits suitable for this type of research

NAPA Rabbit pAb

A7946-100ul 100 ul
EUR 308

NAPA Rabbit pAb

A7946-200ul 200 ul
EUR 459

NAPA Rabbit pAb

A7946-20ul 20 ul
EUR 183

NAPA Rabbit pAb

A7946-50ul 50 ul
EUR 223

Anti-NAPA antibody

STJ110255 100 µl
EUR 277
Description: This gene encodes a member of the soluble NSF attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. The encoded protein plays a role in the completion of membrane fusion by mediating the interaction of N-ethylmaleimide-sensitive factor (NSF) with the vesicle-associated and membrane-associated SNAP receptor (SNARE) complex, and stimulating the ATPase activity of NSF. Alternatively spliced transcript variants have been observed for this gene.

Anti-NAPA Antibody

STJ503074 100 µg
EUR 476

Borrelia NapA (80.0%) [His]

DAGA-467 5ug
EUR 502

NAPA Antibody, HRP conjugated

1-CSB-PA015447LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NAPA Antibody, FITC conjugated

1-CSB-PA015447LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NAPA Antibody, Biotin conjugated

1-CSB-PA015447LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NAPA protein (His tag)

80R-1470 100 ug
EUR 305
Description: Purified recombinant Human NAPA protein